Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.
Species | Rat |
Cat.No | AM5043 |
Product Category | MicroRNA Agomir/Antagomir |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) |
Shipping Info | Room Temperature |
Storage | -20°C / -80°C |
Product Type | microRNA Agomir/Antagomir |
Label | FAM, CY3, CY5, etc. (optional) |
Component | rno-miR-194-5p Agomir/Antagomir Agomir and/or Antagomir (Product Form: Dry Powder) |
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase |
MicroRNA: rno-miR-194-5p
Accession Number: MIMAT0000869
Mature Sequence: UGUAACAGCAACUCCAUGUGGA
Rno-microRNA-194-5p (rno-miR-194-5p) are a rat microRNA. It is a mature miRNA formed from the 5′ end of rat miR-194 stem-loop after being cleaved by the Dicer enzyme.
MiR-194-5p is a regulator of many diseases, it has potential anti-inflammatory and anti-cancer effects. And miR-194-5p can also inhibits ischemia-induced cardiomyocyte injury. Besides, there are also publications that discovered the mechanism by which miR-194-5p can interact with some lncRNAs.
MicroRNAs (miRNA) can participate in the regulation of related physiological and pathological processes by inhibiting the expression of associated genes.
Click here to browse detailed information about rno-miR-194-5p in miRBase.
Introduction and Applications of miRNA Agomir/Antagomir
MiRNA agomir is a kind of chemically modified miRNA mimic. In the antisense strand, 3’ terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by OMe. Agomir can mimic the function of endogenous miRNAs in actual physiological activities.
MiRNA antagomir is a kind of chemically modified miRNA antagonist. 3’-terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by 2’-OMe. Antagomir can block the physiological function of endogenous mature miRNA through a competitive inhibition mechanism.
Agomir and antagomir are usually used in in vivo experiments in animal models and can be administered by tail vein injection and gavage. Agomir and antagomir can also be applied to experiments in vitro cell models, and cell transfection is an effective treatment method.
Why choose rno-miR-194-5p miRNA Agomir/Antagomir from AcceGen?
AcceGen can provide mature and high-quality miRNA agomir/antagomir synthesis services. The product line covers many typical species, including human, mouse, and rat.
In addition, AcceGen provides optional fluorescent dyes to label additional modified agomir/antagomir products to help researchers design more complete experimental protocols.
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
For research use only