MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-568

Accession Number: MIMAT0004892

Mature Sequence: AUGUAUAAAUGUAUACACAC

mmu-miR-568, a 20-nucleotide-long microRNA found in Mus musculus, emerges as a crucial regulator in cellular homeostasis. mmu-miR-568 exerts notable inhibition on the levels of claudin-1, ZO-1, E-cadherin, and phosphorylated STAT3 protein, and leads to the restraint of MODE-K cell proliferation. Its regulatory role extends to the modulation of tight junction (TJ) expression through direct interaction with the 3’-UTR of claudin-1 mRNA. Intriguingly, its upregulation in colitis mice induced by Dextran sulfate sodium (DSS) is mitigated by IL-22 treatment. The well-conserved precursor of mmu-miR-568 suggests its presence in other genomes, while its expression finds amelioration through antioxidant SFN. Click here to browse detailed information about mmu-miR-568 in miRBase.

Introduction to mmu-miR-568 miRNA Agomir/Antagomir and the application

The application of mmu-miR-568 Agomir or Antagomir holds promise as a potential therapeutic avenue for disorders involving tight junction dysregulation. Utilizing Agomir could enhance mmu-miR-568 expression, potentially ameliorating tight junction-related pathologies, while Antagomir could be employed to selectively suppress mmu-miR-568 expression, offering a strategy to counteract its effects in certain diseases or conditions.

Why choose mmu-miR-568 miRNA Agomir/Antagomir from AcceGen?

When considering your options, MIRacle™ mmu-miR-568 miRNA Agomir/Antagomir from AcceGen stands out due to their well-established proficiency in MicroRNA services. Notably, our products offer prolonged stability lasting from 1 week up to 5-6 weeks, making them highly suitable for in vitro and in vivo miRNA functional studies.