Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.
MicroRNA: mmu-miR-5131
Accession Number: MIMAT0020642
Mature Sequence: CGGCGCCCCACGGAGCCCCGAGC
mmu-miR-5131 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5131 in miRBase.
What is MicroRNA Agomir/Antagomir?
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
Why choose mmu-miR-5131 miRNA Agomir/Antagomir from AcceGen?
AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Species | Mouse |
Cat.No | AM4105 |
Product Category | MicroRNA Agomir/Antagomir |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) |
Shipping Info | Room Temperature |
Storage | -20°C / -80°C |
Product Type | microRNA Agomir/Antagomir |
When you publish your research, please cite our product as "AcceGen Biotech Cat.# XXX-0000". In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
For research use only