• Celebrate the holiday season with AcceGen’s highest discounts of the year. Merry Christmas and Happy New Year!

    Learn More
MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-483-5p miRNA Agomir/Antagomir

  • BSL
  • 49
MicroRNA: mmu-miR-483-5p Accession Number: MIMAT0004782 Mature Sequence: AAGACGGGAGAAGAGAAGGGAG mmu-miR-483-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options

MicroRNA: mmu-miR-483-5p

Accession Number: MIMAT0004782
Mature Sequence: AAGACGGGAGAAGAGAAGGGAG
mmu-miR-483-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-483-5p in miRBase.

What is MicroRNA Agomir/Antagomir?

MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.

Why choose mmu-miR-483-5p miRNA Agomir/Antagomir from AcceGen?

AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Species

Mouse

Cat.No

AM3322

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Citation

When you publish your research, please cite our product as "AcceGen Biotech Cat.# XXX-0000". In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

View More
View Product Image

Application

  • For research use only

Inquiring MIRacle™ mmu-miR-483-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button