MicroRNA: mmu-miR-34b-5p
Accession Number: MIMAT0000382
Mature Sequence: AGGCAGUGUAAUUAGCUGAUUGU
Mmu-microRNA-34b-5p (mmu-miR-34b-5p) are a mouse microRNA. It is a mature miRNA formed from the 5′ end of mouse miR-34b stem-loop after being cleaved by the Dicer enzyme.
MiR-34b-5p plays roles in various physiological and pathological processes, including cell proliferation and differentiation, inflammation, cancer, sepsis, cognitive impairment-related diseases, etc.
MicroRNAs (miRNA) can participate in the regulation of related physiological and pathological processes by inhibiting the expression of associated genes.
Click here to browse detailed information about mmu-miR-34b-5p in miRBase.
Introduction and Applications of miRNA Agomir/Antagomir
MiRNA agomir is a kind of chemically modified miRNA mimic. In the antisense strand, 3’ terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by OMe. Agomir can mimic the function of endogenous miRNAs in actual physiological activities.
MiRNA antagomir is a kind of chemically modified miRNA antagonist. 3’-terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by 2’-OMe. Antagomir can block the physiological function of endogenous mature miRNA through a competitive inhibition mechanism.
Agomir and antagomir are usually used in in vivo experiments in animal models and can be administered by tail vein injection and gavage. Agomir and antagomir can also be applied to experiments in vitro cell models, and cell transfection is an effective treatment method.
Why choose mmu-miR-34b-5p miRNA Agomir/Antagomir from AcceGen?
AcceGen can provide mature and high-quality miRNA agomir/antagomir synthesis services. The product line covers many typical species, including human, mouse, and rat.
In addition, AcceGen provides optional fluorescent dyes to label additional modified agomir/antagomir products to help researchers design more complete experimental protocols.
