• Celebrate the holiday season with AcceGen’s highest discounts of the year. Merry Christmas and Happy New Year!

    Learn More
MicroRNA Agomir/Antagomir

MIRacle™ mmu-miR-34b-5p miRNA Agomir/Antagomir

  • BSL
  • 50
MicroRNA: mmu-miR-34b-5p Accession Number: MIMAT0000382 Mature Sequence: AGGCAGUGUAAUUAGCUGAUUGU mmu-miR-34b-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Mouse

Cat.No

AM4220

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

mmu-miR-34b-5p Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

MicroRNA: mmu-miR-34b-5p

Accession Number: MIMAT0000382
Mature Sequence: AGGCAGUGUAAUUAGCUGAUUGU

Mmu-microRNA-34b-5p (mmu-miR-34b-5p) are a mouse microRNA. It is a mature miRNA formed from the 5′ end of mouse miR-34b stem-loop after being cleaved by the Dicer enzyme.

MiR-34b-5p plays roles in various physiological and pathological processes, including cell proliferation and differentiation, inflammation, cancer, sepsis, cognitive impairment-related diseases, etc.

MicroRNAs (miRNA) can participate in the regulation of related physiological and pathological processes by inhibiting the expression of associated genes.

Click here to browse detailed information about mmu-miR-34b-5p in miRBase.

Introduction and Applications of miRNA Agomir/Antagomir

MiRNA agomir is a kind of chemically modified miRNA mimic. In the antisense strand, 3’ terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by OMe. Agomir can mimic the function of endogenous miRNAs in actual physiological activities.

MiRNA antagomir is a kind of chemically modified miRNA antagonist. 3’-terminal is modified by cholesterol, there are two thiol modifications in the 5’-terminal, four thiol modifications in the 3’-terminal, and the whole strand is modified by 2’-OMe. Antagomir can block the physiological function of endogenous mature miRNA through a competitive inhibition mechanism.

Agomir and antagomir are usually used in in vivo experiments in animal models and can be administered by tail vein injection and gavage. Agomir and antagomir can also be applied to experiments in vitro cell models, and cell transfection is an effective treatment method.

Why choose mmu-miR-34b-5p miRNA Agomir/Antagomir from AcceGen?

AcceGen can provide mature and high-quality miRNA agomir/antagomir synthesis services. The product line covers many typical species, including human, mouse, and rat.

In addition, AcceGen provides optional fluorescent dyes to label additional modified agomir/antagomir products to help researchers design more complete experimental protocols.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • For research use only

Inquiring MIRacle™ mmu-miR-34b-5p miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button