Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.
Species | Mouse |
Cat.No | AM3380 |
Product Category | MicroRNA Agomir/Antagomir |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) |
Shipping Info | Room Temperature |
Storage | -20°C / -80°C |
Product Type | microRNA Agomir/Antagomir |
Label | FAM, CY3, CY5, etc. (optional) |
Component | mmu-miR-155-5p Agomir and/or Antagomir (Product Form: Dry Powder) |
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase |
MicroRNA: mmu-miR-155-5p
Accession Number: MIMAT0000165
Mature Sequence: UUAAUGCUAAUUGUGAUAGGGGU
mmu-miR-155-5p, comprising 23 nucleotides, is a microRNA predominantly present in Mus musculus. It is encoded by the MIR155 host gene (MIR155HG) and exhibits notable expression primarily in the thymus and spleen, with minimal to undetectable levels in other tissues under typical physiological conditions. MiR-155 exerts regulatory control over approximately 140 target genes, modulating the expression of various immunomodulatory, tumor-suppressor, and inflammation-related proteins. Distinguished as a proinflammatory and oncogenic miRNA, miR-155-5p is highly prevalent in activated B and T cells, as well as macrophages, where it plays a pivotal role in orchestrating lymphocyte and dendritic cell function, thus contributing significantly to overall immune homeostasis. In the context of the gastrointestinal tract, abnormal miR-155 expression is associated with Helicobacter pylori infection and is elevated in patients afflicted by inflammatory bowel disease (IBD) and colorectal cancer (CRC). This comprehensive understanding underscores miR-155-5p’s multifaceted involvement in various pathophysiological states, including cardiovascular disorders, inflammation, and cancer. Click here to browse detailed information about mmu-miR-155-5p in miRBase.
Introduction and application of mmu-miR-155-5p miRNA Agomir/Antagomir
The MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir holds significant promise in cancer research and prognosis assessment. MiR-155, which is found in high levels in various solid tumors and hematological malignancies, plays a critical role in promoting oncogenic features and is associated with poor prognosis in cancer patients. The miRNA Agomir in this context mimics and enhances the function of miR-155, potentially aiding in understanding its role in tumorigenesis and as an unfavorable prognosis indicator. Conversely, the miRNA Antagomir serves as a powerful tool to competitively inhibit miR-155, offering opportunities to study its impact on tumorigenic processes, including in hematological malignancies like chronic lymphocytic leukemia. This innovative technology provides a means to delve deeper into the regulation of miR-155 and its implications in cancer research and prognosis assessment.
Why choose mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen?
Select MIRacle™ mmu-miR-155-5p miRNA Agomir/Antagomir from AcceGen for enhanced durability, with a sustained impact lasting from a minimum of one week up to 5-6 weeks, setting them apart from standard miRNA mimics and inhibitors. These products are highly suitable for both in vitro and in vivo miRNA functional studies, ensuring long-lasting and reliable results in scientific investigations.
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
For research use only
It is used to increase the activity of mmu-miR-155-5p, helping to study its effects on gene regulation.
The Antagomir is designed to inhibit mmu-miR-155-5p, allowing researchers to assess its role by blocking its function.
It is often used in studies of immune function, cancer, and inflammation to understand miRNA’s role.
Yes, the Antagomir is suitable for use in both cell culture (in vitro) and live animal studies (in vivo).