MicroRNA: mmu-miR-122-5p Accession Number: MIMAT0000246 Mature Sequence: UGGAGUGUGACAAUGGUGUUUG mmu-miR-122-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today
Discover top-quality products tailored for scientific and medical research. Request a personalized quote today to enhance your projects.
mmu-miR-122-5p, a 22-nucleotide-long miRNA originating from Mus musculus, exerts crucial regulatory functions in diverse physiological processes. It influences the tight junction of the blood-testis barrier in mice by targeting occludin, showcasing its role in maintaining barrier integrity. Additionally, mmu-miR-122-5p exhibits expression in renal proximal tubules and myocardial tissue, suggesting its involvement in various organ-specific processes. Remarkably, this miRNA has been linked to diabetes mellitus development, possibly contributing to disease pathogenesis. Moreover, mmu-miR-122-5p has been identified as a potent pro-angiogenic factor that stimulates vascular endothelial growth factor signaling, promoting angiogenesis both in vivo and in vitro. Click here to browse detailed information about mmu-miR-122-5p in miRBase.
Introduction and application of mmu-miR-122-5p miRNA Agomir/Antagomir
MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir is a cutting-edge molecular tool designed for precise modulation of mmu-miR-122-5p expression. The Agomir version allows for efficient upregulation of miR-122-5p, enabling researchers to investigate its impact on various cellular processes and disease pathways. On the other hand, the Antagomir version offers the ability to selectively suppress miR-122-5p, allowing for in-depth studies of its downregulation effects. These tools provide insights into miR-122-5p’s functional roles and potential therapeutic applications in relevant diseases.
Why choose mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen?
MIRacle™ mmu-miR-122-5p miRNA Agomir/Antagomir from AcceGen is an ideal choice due to our extensive expertise in microRNA synthesis. Our agomir and antagomir options are more durable, offering lasting effects of up to 5-6 weeks compared to standard mimics and inhibitors. They are ideal for in vitro and in vivo miRNA functional studies, ensuring reliable and long-lasting results.
Species
Mouse
Cat.No
AM3890
Product Category
MicroRNA Agomir/Antagomir
Size/Quantity
2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info
Room Temperature
Storage
-20°C / -80°C
Product Type
microRNA Agomir/Antagomir
Citation
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
Remarkably, this miRNA has been linked to diabetes mellitus development, possibly contributing to disease pathogenesis. Moreover, mmu-miR-122-5p has been identified as a potent pro-angiogenic factor that stimulates vascular endothelial growth factor signaling, promoting angiogenesis both in vivo and in vitro. 
