Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.
Species | Human |
Cat.No | AM2481 |
Product Category | MicroRNA Agomir/Antagomir |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) |
Shipping Info | Room Temperature |
Storage | -20°C / -80°C |
Product Type | microRNA Agomir/Antagomir |
Label | FAM, CY3, CY5, etc. (optional) |
Component | hsa-miR-653-5p Agomir and/or Antagomir (Product Form: Dry Powder) |
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase |
MicroRNA: hsa-miR-653-5p
Accession Number: MIMAT0003328
Mature Sequence: GUGUUGAAACAAUCUCUACUG
hsa-miR-653-5p is a 21-nucleotide-long RNA molecule found in Homo sapiens. It plays a crucial role in various biological processes, including cell proliferation and apoptosis. Through interactions with protein-coding genes such as 182-FIP, 209L8, 5T4, 5T4-AG, 82-FIP, ABI3BP, ABP-280, ADAMTS-4, ADAMTS11, and ADAMTS3, miR-653-5p regulates important cellular functions. In gastric cancer, it has been shown to mediate disease progression and metastasis by modulating the SOCS6-STAT3 signaling pathway. Additionally, hsa-miR-653-5p functions as a tumor suppressor in prostate and breast cancers. In prostate cancer, it inhibits proliferation and invasion by targeting the SOX30 gene and suppressing the Wnt/β-catenin signaling pathway. In breast cancer, miR-653-5p suppresses cell proliferation, migration, and invasion while promoting apoptosis through its interaction with mitogen-activated protein kinase 6 (MAPK6). These findings underscore the significance of the miR-653-5p-mediated regulatory network in the progression of prostate and breast cancers.
Click here to browse detailed information about hsa-miR-653-5p in miRBase.
Introduction and Application of hsa-miR-653-5p miRNA Agomir/Antagomir
hsa-miR-653-5p miRNA Agomir/Antagomir is a valuable tool for studying the role of microRNA in tumor signaling pathways. The Agomir mimics miR-653-5p to regulate target genes, while the Antagomir inhibits miR-653-5p function. These tools enable researchers to investigate the impact of miR-653-5p on tumor development and identify potential therapeutic targets. They provide insights into non-coding RNA regulation and its involvement in tumor signaling pathways.
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
For research use only