MIRacle™ hsa-miR-653-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-653-5p

Accession Number: MIMAT0003328
Mature Sequence: GUGUUGAAACAAUCUCUACUG

hsa-miR-653-5p is a 21-nucleotide-long RNA molecule found in Homo sapiens. It plays a crucial role in various biological processes, including cell proliferation and apoptosis. Through interactions with protein-coding genes such as 182-FIP, 209L8, 5T4, 5T4-AG, 82-FIP, ABI3BP, ABP-280, ADAMTS-4, ADAMTS11, and ADAMTS3, miR-653-5p regulates important cellular functions. In gastric cancer, it has been shown to mediate disease progression and metastasis by modulating the SOCS6-STAT3 signaling pathway. Additionally, hsa-miR-653-5p functions as a tumor suppressor in prostate and breast cancers. In prostate cancer, it inhibits proliferation and invasion by targeting the SOX30 gene and suppressing the Wnt/β-catenin signaling pathway. In breast cancer, miR-653-5p suppresses cell proliferation, migration, and invasion while promoting apoptosis through its interaction with mitogen-activated protein kinase 6 (MAPK6). These findings underscore the significance of the miR-653-5p-mediated regulatory network in the progression of prostate and breast cancers.

Click here to browse detailed information about hsa-miR-653-5p in miRBase.

Introduction and Application of hsa-miR-653-5p miRNA Agomir/Antagomir

hsa-miR-653-5p miRNA Agomir/Antagomir is a valuable tool for studying the role of microRNA in tumor signaling pathways. The Agomir mimics miR-653-5p to regulate target genes, while the Antagomir inhibits miR-653-5p function. These tools enable researchers to investigate the impact of miR-653-5p on tumor development and identify potential therapeutic targets. They provide insights into non-coding RNA regulation and its involvement in tumor signaling pathways.