• Celebrate the holiday season with AcceGen’s highest discounts of the year. Merry Christmas and Happy New Year!

    Learn More
MicroRNA Agomir/Antagomir

MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir

  • BSL
  • 115
MicroRNA: hsa-miR-429 Accession Number: MIMAT0001536 Mature Sequence: UAAUACUGUCUGGUAAAACCGU hsa-miR-429 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today

Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.

Get a Quote
  • High Purity Levels
  • Precision and Reliability
  • Customization Options
Species

Human

Cat.No

AM2278

Product Category MicroRNA Agomir/Antagomir
Size/Quantity

2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)

Shipping Info

Room Temperature

Storage

-20°C / -80°C

Product Type

microRNA Agomir/Antagomir

Label

FAM, CY3, CY5, etc. (optional)

Component

hsa-miR-429 Agomir and/or Antagomir (Product Form: Dry Powder)
Agomir N.C and/or Antagomir N.C (optional)

Key Features

*cover all human, mouse, and rat miRNAs listed in miRBase
*higher stability/inhibitory effects in vivo and in vitro
*more stable, easier to pass the cell membrane and tissue gap
*purified and ready-to transfect cells/be administered by injection, inhalation, feeding
*less reagent use amount with longer effect time

Description

Hsa-miR-429 is a specific type of microRNA (miRNA) found in humans. MicroRNAs are small, single-stranded RNA molecules that play crucial roles in regulating gene expression at the post-transcriptional level. Hsa-miR-429 is derived from the precursor miRNA hsa-miR-429, and its mature sequence is typically around 22 nucleotides in length.

MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir

 

MicroRNAs like hsa-miR-429 function by binding to complementary sequences in the 3′ untranslated region (UTR) of target messenger RNA (mRNA) molecules, leading to the inhibition of protein translation or degradation of the mRNA. This regulatory mechanism allows microRNAs to modulate the expression of genes involved in various biological processes, including development, differentiation, proliferation, apoptosis, and metabolism..

 

Designed to cover the spectrum of human, mouse, and rat miRNAs cataloged in miRBase, these antagomirs offer a superior alternative for inhibiting miRNA function both in vivo and in vitro. Their heightened stability and inhibitory effects distinguish them from conventional miRNA inhibitors. This is attributed to their robust competition with mature miRNAs, impeding their complementary pairing with target genes and, consequently, restraining the regulatory actions of miRNAs.

 

Why choose MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir from AcceGen?

 

Enhanced Stability and Inhibitory Effects

These antagomirs exhibit superior stability and sustained inhibitory effects, surpassing traditional miRNA inhibitors.

 

Improved Cellular Uptake

Their well-designed structure facilitates enhanced cellular uptake, ensuring efficient delivery to target cells.

 

Versatile Administration

Purified and ready for transfection, these antagomirs can be seamlessly administered through various routes, including injection, inhalation, or feeding.

 

Long-lasting Effects

With a reduced reagent usage and prolonged effect duration, these antagomirs offer a cost-effective solution for sustained miRNA modulation.

View Product Image

Citation

When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).

Application

  • FOR RESEARCH USE ONLY

  •  

  • Here are key applications:

  •  

  • MiRNA Functional Studies

  • Researchers can employ hsa-miR-429 Agomir/Antagomir to investigate the functional roles of miRNAs in various biological processes. The controlled modulation allows for a better understanding of the impact of miRNA expression on cellular functions.

  •  

  • Gene Regulation Studies

  • The Agomir/Antagomir can be utilized to study the regulatory effects of hsa-miR-429 on target genes. By modulating miRNA levels, researchers can observe changes in gene expression, providing insights into the molecular mechanisms involved.

  •  

  • Disease Research

  • MiRNAs often play crucial roles in disease development and progression. The hsa-miR-429 Agomir/Antagomir can be applied to explore the involvement of this specific miRNA in various diseases, aiding in the identification of potential therapeutic targets.

  •  

  • Cancer Research

  • Aberrant miRNA expression is frequently observed in cancer. Researchers can use the Agomir/Antagomir to investigate the role of hsa-miR-429 in cancer-related processes, such as proliferation, invasion, and metastasis.

  •  

  • In Vivo Studies

  • The Agomir/Antagomir’s enhanced stability and sustained inhibitory effects make it suitable for in vivo studies. Researchers can administer these molecules through injection, inhalation, or feeding to explore miRNA functions in live animal models.

  •  

  • Long-term Modulation

  • The Agomir/Antagomir’s extended stability allows for long-term miRNA modulation. This is particularly beneficial for studies requiring prolonged and controlled changes in miRNA expression.

  •  

  • Versatile Research Models

  • The Agomir/Antagomir covers hsa-miR-429 in human models, providing versatility for researchers working with human miRNA regulation.

  •  

Frequently Asked Questions

  • What is hsa-miR-429 and what role does it play in cells?

    The hsa-miR-429 is a microRNA (miRNA) that regulates gene expression post-transcriptionally. It plays important roles in various cellular processes such as cell proliferation, differentiation, and epithelial-mesenchymal transition (EMT) in humans.

  • What are the potential applications of hsa-miR-429 Agomirs in research?

    The hsa-miR-429 Agomirs are valuable tools for studying the biological functions of hsa-miR-429 in various cellular contexts. Researchers can use them to investigate the role of hsa-miR-429 in disease processes such as cancer progression, fibrosis, and developmental disorders. They can also explore its potential as a therapeutic target.

  • How do hsa-miR-429 Antagomirs contribute to scientific studies?

    The hsa-miR-429 Antagomirs enable researchers to study the effects of reducing hsa-miR-429 levels. By inhibiting hsa-miR-429 function, Antagomirs provide insights into the biological consequences of hsa-miR-429 dysregulation, offering potential therapeutic strategies for diseases where hsa-miR-429 plays a critical role.

Inquiring MIRacle™ hsa-miR-429 miRNA Agomir/Antagomir

We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
High Viability
To succeed in cell culture
Precision and Reliability
To support a consistent result
Customization Options
Tailed to your research

Tags

AcceGen Scroll Top Button