Discover top-quality products tailored for scientific and medical research. Request a personalized quote today
to enhance your projects.
Species | Human |
Cat.No | AM0741 |
Product Category | MicroRNA Agomir/Antagomir |
Size/Quantity | 2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug) |
Shipping Info | Room Temperature |
Storage | -20°C / -80°C |
Product Type | microRNA Agomir/Antagomir |
Label | FAM, CY3, CY5, etc. (optional) |
Component | hsa-miR-21-5p Agomir and/or Antagomir (Product Form: Dry Powder) |
Key Features | *cover all human, mouse, and rat miRNAs listed in miRBase |
MicroRNA: hsa-miR-21-5p
Accession Number: MIMAT0000076
Mature Sequence: UAGCUUAUCAGACUGAUGUUGA
hsa-miR-21-5p is a widely studied circulating microRNA that exhibits strong evolutionary conservation. It has been extensively investigated in various diseases, particularly cancer and cardiovascular conditions. Identified as an onco-miRNA, hsa-miR-21-5p influences the expression of multiple cancer-related genes and is dysregulated in several tumors. Notably, this miRNA is present in different extracellular fluids like plasma, serum, CSF, saliva, gastric juice, pancreatic juice, sputum, and pancreatic cyst fluid. Elevated levels of hsa-miR-21-5p are associated with tumor growth, metastasis, and chemotherapy resistance. In cancer, it serves as a negative predictor of survival. Additionally, hsa-miR-21-5p plays crucial roles in various malignancies and cardiovascular diseases, affecting processes like cell proliferation, apoptosis, and fibroblast functions in the heart and vascular system. Click here to browse detailed information about hsa-miR-21-5p in miRBase.
Introduction and application of hsa-miR-21-5p miRNA Agomir/Antagomir
The application of hsa-miR-21-5p miRNA Agomir and Antagomir offers valuable insights into gene regulation and potential therapeutic avenues. The MicroRNA Agomir, a chemically modified double-stranded RNA, mimics hsa-miR-21-5p’s function, facilitating the investigation of its target gene modulation. Conversely, the MicroRNA Antagomir acts as a powerful antagonist, competitively inhibiting hsa-miR-21-5p and other miRNAs’ activities, thereby uncovering their roles in disease pathways and offering opportunities for targeted therapeutic interventions in conditions like cancer, cardiovascular diseases, and other miRNA-related disorders.
Why choose hsa-miR-21-5p miRNA Agomir/Antagomir from AcceGen?
MIRacle™ hsa-miR-21-5p miRNA Agomir/Antagomir from AcceGen is a good choice for its superior quality, reliability, and performance. AcceGen’s products undergo rigorous testing and are specially designed with advanced chemical modifications to ensure optimal and specific miRNA regulation. With MIRacle™ products, researchers can confidently explore the roles of hsa-miR-21-5p in gene regulation and potential therapeutic applications with precision and accuracy.
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
For research use only