MicroRNA: hsa-miR-206 Accession Number: MIMAT0000462 Mature Sequence: UGGAAUGUAAGGAAGUGUGUGG hsa-miR-206 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation […]
Request Your Custom Quote Today
Discover top-quality products tailored for scientific and medical research. Request a personalized quote today to enhance your projects.
MIRacle™ hsa-miR-206 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression.
MicroRNA Agomir
MicroRNA Agomir is a chemically modified, double-stranded small RNA labeled for enhanced functionality. Acting as a mimic of endogenous miRNA, it exerts precise control over the biological functions of target genes. The Agomir covers a comprehensive range of miRNAs listed in miRBase for human, mouse, and rat, ensuring a broad applicability across species.
MicroRNA Antagomir
MicroRNA Antagomir serves as a potent antagonist, finely tuned through chemical modifications. Its robust competitive binding with mature miRNAs within the body effectively hinders the complementary pairing of miRNAs with their target genes. This inhibition results in the suppression of miRNA function, opening avenues for investigating specific gene regulation pathways.
Why choose hsa-miR-206 miRNA Agomir/Antagomir from AcceGen?
AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies. AcceGen’s hsa-miR-206 miRNA Agomir/Antagomir stands out with unique features that elevate your research to new heights.
Comprehensive Coverage: Encompassing all human, mouse, and rat miRNAs cataloged in miRBase, these tools provide an expansive repertoire for researchers seeking to explore a wide range of biological processes.
Enhanced Stability and Inhibitory Effects: Exhibiting superior stability and inhibitory effects both in vivo and in vitro, these molecules offer heightened efficiency in modulating miRNA-mediated gene regulation.
Improved Cellular Uptake: With enhanced stability, MicroRNA Agomir/Antagomir demonstrates increased ease in traversing cell membranes and tissue gaps, facilitating seamless delivery to target cells.
Flexible Administration: Purified and ready for transfection, these molecules can be administered through various routes, including injection, inhalation, and feeding. This adaptability streamlines experimental design and ensures convenience in diverse research settings.
Cost-Efficient and Long-Lasting Impact: Significantly reducing the amount of reagents required, MicroRNA Agomir/Antagomir provides a cost-effective solution. Moreover, their prolonged effect time minimizes the need for frequent re-administration, optimizing resource utilization.
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
Why choose hsa-miR-206 miRNA Agomir/Antagomir from AcceGen?
AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.
Species
Human
Cat.No
AM1367
Product Category
MicroRNA Agomir/Antagomir
Size/Quantity
2 OD, 4 OD, 50 OD (size by request, 1 OD corresponds to 33 ug)
Shipping Info
Room Temperature
Storage
-20°C / -80°C
Product Type
microRNA Agomir/Antagomir
Citation
When you publish your research, please cite our product as “AcceGen Biotech Cat.# XXX-0000”. In return, we’ ll give you a $100 coupon. Simply click here and submit your paper’ s PubMed ID (PMID).
View More
View Product Image
Application
FOR RESEARCH USE ONLY
Recent research has shown that miRNAs cover a wide range of diseases, including several types of cancer. It is interesting to note that miR-206 operates as a tumor suppressor and is downregulated in abundant cancer types, such as breast cancer, lung cancer, colorectal cancer, and so forth. Interestingly, a growing number of studies have also reported that miR-206 could function as an oncogene and promote tumor cell proliferation. Thereby, miR-206 may act as either oncogenes or tumor suppressors under certain conditions. In addition, it was widely acknowledged that restoring tumor-suppressor miR-206 has emerged as an unconventional cancer therapy strategy. Therefore, miR-206 might be a newfangled procedure for achieving a more significant treatment outcome for cancer patients.
We know how valuable your research is to you, but are you wondering what you can expect to pay for quick accurate results every time? Fill out a request in the form below and we’ll get back to you within 24 hours with a quote.
MIRacle™ hsa-miR-206 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression.
