MIRacle™ hsa-miR-17-5p miRNA Agomir/Antagomir

Description

MicroRNA: hsa-miR-17-5p

Accession Number: MIMAT0000070

Mature Sequence: CAAAGUGCUUACAGUGCAGGUAG

hsa-miR-17-5p is 23 nucleotides long and is found in Homo sapiens. miR-17-5p, a versatile microRNA, exhibits dual roles as both an oncogene and a tumor suppressor, contextually dependent. Elevated levels in numerous malignancies correlate with poor outcomes. In HEK293T cells, miR-17-5p autonomously prompts proliferation. It targets a spectrum of genes, encompassing pro- and anti-proliferative ones. Notably, in HEK293T cells, secondary and/or tertiary effects selectively amplify pro-proliferative mRNA expressions. In prostate cancer, recent research identified heightened miR-17-5p expression as an independent, adverse prognostic marker, underscoring its pivotal impact on disease progression. Click here to browse detailed information about hsa-miR-17-5p in miRBase.

Introduction and Application of hsa-miR-17-5p miRNA Agomir/Antagomir

The application of hsa-miR-17-5p miRNA Agomir involves utilizing a chemically modified double-stranded RNA that emulates the natural miRNA’s role to regulate target gene function. On the other hand, hsa-miR-17-5p miRNA Antagomir serves as an antagonist, competently obstructing the binding of endogenous miRNAs to their target genes. These tools can be harnessed to modulate the activity of hsa-miR-17-5p, offering potential for fine-tuned control over gene expression and downstream biological processes.

Why choose hsa-miR-17-5p miRNA Agomir/Antagomir from AcceGen?

MIRacle™ hsa-miR-17-5p miRNA Agomir/Antagomir from AcceGen is an ideal choice due to enhanced durability. Unlike standard miRNA mimics and inhibitors, these products offer prolonged effects, lasting from a minimum of 1 week to up to 5-6 weeks, thanks to their increased resistance to degradation.