Home > Products > MicroRNA Agomir/Antagomir >
MicroRNA Agomir/Antagomir
MicroRNA (miRNA) is a type of endogenous small RNA with a length of about 20-24 nucleotides. A combination of several miRNAs can be used to fine-tune the expression of a gene.
MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene.
MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning.
NOMENCLATURE
- 1. The miRNA mature body is abbreviated as miR, and then according to its species name, such as the human being abbreviated as hsa, and the order in which it was found is represented by Arabic numerals, such as hsa-miR-122.
- 2. Highly homologous miRNAs are followed by lowercase letters (a, b, c, …), such as hsa-miR-34a, hsa-miR-34b, hsa-miR-34c, and so on.
- 3. MiRNAs with the same mature sequence are transcribed and processed from DNA sequences on different chromosomes, followed by Arabic numerals to indicate the difference, such as hsa-miR-199a-1 and hsa-miR-199a-2.
- 4. Generally, a miRNA precursor is about 70-80nt in length. It is likely that miRNAs are generated by the two arms, and they are named by “-5p” and “-3p”. For example, hsa-miR-26b-5p and hsa-miR-26b-3p indicate that they are processed from the 5 ‘end arm and 3’ end arm of the hsa-mir-26b precursor, respectively.
AcceGen is committed to providing ready-to-use MicroRNA Agomir/Antagomir for your basic research. Use the Standard Nomenclature to search, if you cannot find the specific product in our database, AcceGen MicroRNA Agomir/Antagomir Synthesis Service is committed to paving new ways to meet all your needs.
Click on the selected item to view the products:
| Cat.# | Name | Description | Stock | Price |
|---|---|---|---|---|
| AM5288 | MIRacle™ tca-miR-31-5p miRNA Agomir/Antagomir | MicroRNA: tca-miR-31-5p Accession Number: MIMAT0008362 Mature Sequence: AGGCAAGAUGUCGGCAUAGCU tca-mi...more | +inquiry | |
| AM5289 | MIRacle™ tca-miR-276-3p miRNA Agomir/Antagomir | MicroRNA: tca-miR-276-3p Accession Number: MIMAT0008381 Mature Sequence: UAGGAACUUCAUACCGUGCUCU tca-...more | +inquiry | |
| AM5290 | MIRacle™ fru-miR-22a miRNA Agomir/Antagomir | MicroRNA: fru-miR-22a Accession Number: MIMAT0003099 Mature Sequence: AAGCUGCCAGCUGAAGAACUGU fru-miR...more | +inquiry | |
| AM5280 | MIRacle™ bmo-miR-14-5p miRNA Agomir/Antagomir | MicroRNA: bmo-miR-14-5p Accession Number: MIMAT0015227 Mature Sequence: CGGGGAGAGAAAUCGACGAGGCU bmo-...more | +inquiry | |
| AM5281 | MIRacle™ bmo-miR-14-3p miRNA Agomir/Antagomir | MicroRNA: bmo-miR-14-3p Accession Number: MIMAT0004196 Mature Sequence: UCAGUCUUUUUCUCUCUCCUA bmo-mi...more | +inquiry | |
| AM5282 | MIRacle™ bmo-miR-2739 miRNA Agomir/Antagomir | MicroRNA: bmo-miR-2739 Accession Number: MIMAT0012617 Mature Sequence: GAGAUGUGGAUAUUAUGGUGUGGAGG bm...more | +inquiry | |
| AM5283 | MIRacle™ bmo-miR-993b-5p miRNA Agomir/Antagomir | MicroRNA: bmo-miR-993b-5p Accession Number: MIMAT0015297 Mature Sequence: UACCCUGUAGAUCCGGGCUUUCG bm...more | +inquiry | |
| AM5284 | MIRacle™ bmo-miR-9c-5p miRNA Agomir/Antagomir | MicroRNA: bmo-miR-9c-5p Accession Number: MIMAT0015302 Mature Sequence: UCUUUGGUAUCCUAGCUG bmo-miR-9...more | +inquiry | |
| AM5285 | MIRacle™ cte-miR-34 miRNA Agomir/Antagomir | MicroRNA: cte-miR-34 Accession Number: MIMAT0009516 Mature Sequence: UGGCAGUGUGGUUAGCUGGUUGU cte-miR...more | +inquiry | |
| AM5286 | MIRacle™ gga-miR-155 miRNA Agomir/Antagomir | MicroRNA: gga-miR-155 Accession Number: MIMAT0001106 Mature Sequence: UUAAUGCUAAUCGUGAUAGGGG gga-miR...more | +inquiry | |
| AM5287 | MIRacle™ tca-miR-277-3p miRNA Agomir/Antagomir | MicroRNA: tca-miR-277-3p Accession Number: MIMAT0008382 Mature Sequence: UAAAUGCACUAUCUGGUACGACA tca...more | +inquiry | |
| AM5272 | MIRacle™ oar-miR-199a-3p miRNA Agomir/Antagomir | MicroRNA: oar-miR-199a-3p Accession Number: MIMAT0030040 Mature Sequence: ACAGUAGUCUGCACAUUGGUU oar-...more | +inquiry | |
| AM5273 | MIRacle™ chi-miR-101-3p miRNA Agomir/Antagomir | MicroRNA: chi-miR-101-3p Accession Number: MIMAT0035900 Mature Sequence: UACAGUACUGUGAUAACUGA chi-mi...more | +inquiry | |
| AM5274 | MIRacle™ api-miR-71 miRNA Agomir/Antagomir | MicroRNA: api-miR-71 Accession Number: MIMAT0014735 Mature Sequence: UGAAAGACAUGGGUAGUGAGAUG api-miR...more | +inquiry | |
| AM5275 | MIRacle™ api-miR-263b miRNA Agomir/Antagomir | MicroRNA: api-miR-263b Accession Number: MIMAT0014720 Mature Sequence: CUUGGCACUGGAAGAAUUCACAGA api-...more | +inquiry | |
| AM5260 | MIRacle™ hsa-let-7d-5p miRNA Agomir/Antagomir | MicroRNA: hsa-let-7d-5p Accession Number: MIMAT0000065 Mature Sequence: AGAGGUAGUAGGUUGCAUAGUU hsa-l...more | +inquiry | |
| AM5276 | MIRacle™ api-miR-278 miRNA Agomir/Antagomir | MicroRNA: api-miR-278 Accession Number: MIMAT0014723 Mature Sequence: UCGGUGGGACUUUCGUUCGUUU api-miR...more | +inquiry | |
| AM5261 | MIRacle™ hsa-let-7d-3p miRNA Agomir/Antagomir | MicroRNA: hsa-let-7d-3p Accession Number: MIMAT0004484 Mature Sequence: CUAUACGACCUGCUGCCUUUCU hsa-l...more | +inquiry | |
| AM5277 | MIRacle™ api-miR-3024 miRNA Agomir/Antagomir | MicroRNA: api-miR-3024 Accession Number: MIMAT0014760 Mature Sequence: UCUUUGGGAUUUAAUAGAGCCGGU api-...more | +inquiry | |
| AM5262 | MIRacle™ hsa-let-7e-5p miRNA Agomir/Antagomir | MicroRNA: hsa-let-7e-5p Accession Number: MIMAT0000066 Mature Sequence: UGAGGUAGGAGGUUGUAUAGUU hsa-l...more | +inquiry |
